MASTER THESISIn Order to Obtain theRESEARCH MASTER InImmunologyPresented and defended by:Sara ZalghoutOn Friday September 29, 2017Title Angiotensin II Effect on Vascular Calcification: Target and ApproachSupervisorsDr.
Eva HamadeDr. Ghewa Al-AchkarReviewersProf. Bassam Badran Dr. Michella Ghassibe Université Libanaise -Faculté des sciencesAcknowledgementI would like to express my deepest appreciation to Dr.Eva HAMADE who, despite her many academic and professional commitments, never failed to be the supervisor I needed.
Without her guidance, encouragement and persistent support, this thesis would not have been possible.My co-director Dr.Aida HABIB, who accepted me as a master student to work on my project and initiate research in her lab, I would like to express my deepest gratitude and how it is an honor to be a part of her team. I would also like to thank her for the care and spirits she provided during the course of this thesis.Moreover, I owe the deepest gratitude to Prof.
Bassam BADRAN and Dr. Michella GHASSIBE for taking the time to read my report and for giving their valuable comments regarding it.I would also like to express my thanks for Dr. Asaad ZAIDAN and the research assistant Rima Farhat for providing necessary facilities and equipments.My sincere thanks for the experts, Dr.Ghewa AL-ACHKAR, for her immense patience and support while teaching me lab techniques, data analysis, and following my work step by step; and my lab members especially Abeer Ayoub and Naify Ramadan, who adorned this work with their fingerprints.I would also like to acknowledge my colleagues and friends for their moral support and advice despite of the enormous pressure we were facing together.Finally, I must express my very profound gratitude to my parents for providing me with unfailing support and continuous encouragement throughout my years of study, for believing in me, and giving me the opportunity for education.
Table of ContentsTable of Contents 3List of Abbreviations 5List of Tables and Figures 7Abstract 8Chapter I: Introduction 91.Vascular Calcification 92.Bone physiology and mineralization 102.
1Biomineralization Process 102.2.Bone and Cartilage proteins: Runx2, OPN, OCN, MGP 123.Physiology of the Aorta 144.Passive versus active model 165.VSMC plasticity 176.Causes of VC: 186.
1.VC and CKD 186.2.VC and Diabetes 196.3.
VC and Atherosclerosis 216.4.VC and Hypertension 227.Autophagy 257.
1.Autophagy and vascular biology 26Aim of the Project 27Chapter II: Materials and methods 282.Experimental Design 283.Von kossa staining 284.Alizarin Red S 285.
DHE experiment 296.RNA Extraction 297.Reverse transcription-PCR: 308.Real-Time PCR 309.
Statistical analysis 30Chapter III: Results 321-Ang II induces aortic arch calcification after 72 hrs incubation (Alizarin Red S and Von Kossa) 322-Ang II induces ROS production after 72 hrs incubation 333.Ang II treatment for 72 hrs induce VSMC trans-differentiation into osteo/chondrocyte like cells 344. Ang II induce inflammation in rat aortic arches after 72 hrs incubation 355.
Ang II incubation for 72 hrs enhance PLD1 activity 36Chapter IV: Discussion and Conclusion: 38Chapter V: Future perspectives: 40References: 40List of AbbreviationsAdenosine triphosphate ATPAdvanced glycoprotein end products AGEsAlpha smooth muscle actin ?-SMAAngiotensin type 1 receptor AT1RAngiotensin type 2 receptor AT2RAngiotensin type receptor blocker ARBAnkylosis protein homolog ANKHAnnexin A5 AnxA5Apolipoprotein-E Apo-EBiomineralization foci BMFBone morphogenetic protein BMPCalcium CaCardiovascular disease CVDChronic kidney disease CKDCytochrome p450 27B1 CYP27B1Diacyl glycerol DAGEndoplasmic reticulum ERFatty acids FAsFibroblast growth factor-23 FGF-23Guanosine triphosphate GTPHydrogen peroxide H2O2Hydroxyapatite HAInorganic phosphate PiInorganic pyrophosphate PPiInositol-1,4,5-triphosphate IP3Interleukin 6 IL-6Low density lipoprotein LDLMatrix Gla protein MGPMatrix metalloproteinase MMPMatrix vesicles MVsMitogen activated protein MAPMonocyte chemoattractant protein MCPMyosin light chain kinase MLCKMyosin light chain phosphatase MLCPNicotinamide adenine dinucleotide phosphate NADPHNitric oxide NONuclear factor kappa-B NF-?BOsteocalcin OCNOsteopontin OPNOsteoprotegerin OPGOxidized LDL receptor-1 Parathyroid hormone PTHPeroxisome proliferator-activated receptor gamma PPAR-?Phosphate PPhosphatidic acid PAPhosphatidylcholine PC Phosphatidylethanolamine PE Phosphoethanolamine/phosphocholine phosphatase PHOSPHO1Phospholipase C PLCPhospholipase D PLDProtein kinase C PKCReactive oxygen species ROSReceptor activator of nuclear factor kappa-B RANKRenin Angiotensin aldosterone system RAASRunt-related transcription factor 2 Runx-2Smooth Muscle 22 alpha SM22?Superoxide anion •O2-Superoxide dismutase SODTissue nonspecific alkaline phosphatase TNAPTumor necrosis factor alpha TNF-?Vascular Calcification VCVascular Smooth Muscle Cell VSMCList of Tables and FiguresTable 1: Soluble biomarkers and regulators of calcificationTable 2: List of primers used in qRT-PCR.Figure 1: Schematic illustration of the process of mineralizationFigure 2: Different types of arterial calcificationFigure 3: Mineralizing VSMC elaborate markers of osteo/chondrocyte like cellFigure 4: Mechanisms whereby Ang II induces vascular injuryFigure 5: Aortic arch calcification induced by 72 hrs incubation with Ang II.Figure 6: Ang II induces ROS generation in rat aortic arches after 72 hrs incubationFigure 7: Trandifferentiation of arterial arch cells into osteo/chondrocyte like cells.Figure 8: Ang II induces inflammation in rat aortic arches after 72 hrs incubation.
Figure 9: Ang II induces PLD1 expression in rat aortic arches after 72 hrs incubation.AbstractVascular calcification (VC) is an active and complex process that involves multiple molecular mechanisms leading to calcium deposition in vessel wall. It was considered a passive process that occurs as a result of elevated calcium-phosphate product. However, it is now accepted as an active process where variety of stimuli including hyperphosphatemia, dislipedemia, and oxidative stress induce vascular smooth muscle (VSMC) cells trans-differentiation into osteoblast-like cells. Simultaneous increase in arterial osteochondrocytic programs and reduction in active cellular defense mechanisms demonstrated by loss of inhibitors; create an adequate niche for vascular calcification. Renin-angiotensin-aldosterone system (RAAS) alterations are widely associated with cardiovascular diseases as Angiotensin II (Ang II) is a potent stimulator of VC. Ang II mediates its effects in vascular injury primarily through inducing oxidative stress and inflammation, and as a consequence, calcification biomarkers are upregulated.
In this study, we investigated whether arterial arches calcify following 72 hours treatment with Ang II. Our results show that Ang II induces reactive oxygen species (ROS) generation and the upregulation of the inflammatory biomarker tumor necrosis factor-? (TNF-?). Moreover, the mRNA level of expression of mineralizing biomarkers osteopontin (OPN) and osteocalcin (OCN) was significantly elevated suggesting VSMC trans-differentiation into osteo/chondrocyte like cells. Thus Ang II treatment for 72 hrs induces arterial arch calcification upon oxidative stress and inflammation stimulation.Key words: Vascular calcification, VSMC, Ang II, oxidative stress, inflammationChapter I: Introduction1.Vascular CalcificationVascular calcification (VC) is the deposition of hydroxyapatite (HA) crystals in the vasculature. It is considered as a bad clinical outcome and a predictor of cardiovascular adverse events 1. It is one of the mechanisms involved in arterial remodeling which refers to a multitude of structural and functional changes in the vascular wall 2.
The process of VC is highly similar to physiological mineralization however it occurs in soft tissues (kidney, articular cartilage, cardiovascular tissues) rather than hard ones (bone, cartilage, dentin) 3.VC is complex and involves the trans-differentiation of vascular smooth muscle cells (VSMC) into osteo/chondrocyte like cells associated with an increase in osteogenic proteins 4. It occurs due to the loss of coordination between stimulatory and inhibitory factors including chemical compounds, enzymes, and proteins (discussed later) 1.
Of the various tissues vulnerable to ectopic calcification, VC is the most worrying considered as a complexity leading to increased morbidity and mortality associated with cardiovascular diseases 5. Individuals with particular conditions are greatly prone to develop soft tissue calcification including elderly, individuals with specific life style aspects, metabolic or hormonal disorders, or with genetic diseases 2.VSMC in advanced aged individuals increase the expression of senescence markers ‘prelamin A’ involved in DNA damage and disrupting mitosis favoring VC 6. Moreover, exogenous excessive generation and inhalation of free radicals from cigarette smoking induce oxidative stress, the process greatly associated with cardiovascular disease 7. Hyperglycemia also induces oxidative and osmotic stress activating vascular inflammatory cells and inducing VSMC trans-differentiation. A major contributor of VC pathology is hyperphosphatemia in patients with chronic kidney disease (CKD) as considered a great risk factor of calcium accumulation in vessel wall, in addition increased parathyroid hormone (PTH) in patients with CKD inhibit osteoprotegerin (OPG), main osteoprotective factor 8.
Hypervitamosis D is associated with extensive arterial calcium phosphate deposit and upregulation of proteins regulating mineralization9. Mutation in the gene encoding fibroblast growth factor-23 (FGF-23) contribute to VC in CKD patients as it functions in the inhibition of tubular phosphate reabsorption 8. Moreover, calcification is a hallmark of patients with genetic diseases, including, Keutel syndrome, Psedoxanthoma elasticum (PXE) and PXE-like syndrome 2.
2.Bone physiology and mineralizationBone is a highly specialized connective tissue which has important physiological and mechanical functions 10. In addition to its role in providing rigidity to the skeleton for locomotion and protection of visceral organs; it plays other crucial vital functions 11.
Bone formation occurs by either process: endochondral ossification or intramembraneous ossification 12. Bone as a structure consists of matrix, minerals and osteogenic cells. The matrix is composed mainly of type I collagen, proteoglycans, and non-collagenous proteins including osteopontin (OPN), osteocalcin (OCN) and osteonectin secreted by osteoblasts. Two thirds of total bone matrix is made up of HA crystals or calcium phosphate ions. Other minerals include magnesium, potassium, and sodium 10.Cells within the bone include osteoblast, osteoclast, and osteocytes. Osteoblasts major function is the synthesis of collagen and organic matrix.
Osteoclasts functions in bone remodeling i.e. degradation of the bone matrix by the release of acid and lytic enzymes 13. Osteocytes act as mechanosensors converting the mechanical force stimulus into biochemical signals and actively involved in bone turnover 14.2.1Biomineralization ProcessBiomineralization is the process of mineral deposition in particular tissues leading to hardening and stiffening of the mineralized tissue.
It occurs in various living organisms, of which are the vertebrates where the deposited mineral is HA. It is a well-orchestrated process of crystal formation within matrix vesicles (MVs) budding from the surface of hypertrophic chondrocytes, osteoblasts and odontoblast and their deposition in between collagen fibrils lying in the extracellular matrix.15 Recent in vitro studies have shown that MVs are not the exclusive vesicles which function in HA nucleation. Rather, in various osteoblastic cultures, nucleation occurs within various cell derived structures including in addition to MVs, calcospherulites and biomineralization foci.16 In this manuscript focus will be on MVs because these are the most studied and well defined. MVs are membrane invested vesicles that contain all necessary biochemical machinery required for availability of raw mineralization materials and balancing the inorganic pyrophposphate/ inorganic phosphate (PPi/Pi) ratio. A recent proposed mechanism for mineralization steps include: 1) HA crystals nucleation within MVs, 2) MVs bud from bone (cartilage or dentin) forming cells and interact with collagen fibrils through specific proteins and lipids, 3) MVs rupture and release HA into extracellular matrix (ECM).
17 Tissue nonspecific alkaline phosphatase (TNAP) is an ectoenzyme linked to MVs membrane by glycosylphosphatidylinositol and function in hydrolysis of PPi providing Pi. 18PPi inhibit hydroxyapatite formation by binding to these crystals and preventing further growth. PPi is provided by ectonucleotidepyrophoshatase (NPP1) by the hydrolysis of adenosine triphosphate (ATP) preferentially and other nucleoside triphosphates such as guanosine triphosphates (GTP). PPi can also be provided from the membrane transporter: progressive Ankylosis protein homolog (ANKH). Within MVs Pi are provided by type III sodium/inorganic phosphate (Na/Pi) cotransporter and PHOSPHO1.
PHOSPHO1 is a cytosolic phosphatase which cleaves Phosphatidylethanolamine (PE) and Phosphatidylcholine (PC) releasing Pi.19 The internal layer of MVs is rich in phosphatidylserine, a lipid with high affinity for both calcium and phosphate. MVs have the ability of interaction with collagen type II and X mediated by membrane bound annexin A5 (AnxA5) which are Ca2+ and phospholipid binding proteins stimulating Ca2+ influx into the vesicles.20 The process is mediated by the action of several molecules and steps making it highly regulated and complex(Figure 1). Ectopic expression of TNAP is a very imortant factor behind pathological calciification knowing that TNAP and collagen type I proteins are sufficient for triggering extracellular matrix mineralization.20 Figure 1: Schematic illustration of the process of mineralization.152.2.
Bone and Cartilage proteins: Runx2, OPN, OCN, MGPAs previously mentioned the process of calcification is highly similar to biomineralization and associated with imbalance of stimulators and inhibitors, Herein are some examples of most studied critical markers, their mechanism of action, and how their level of expression is modified in VC.(Table 1)Runt-related transcription factor 2 (Runx 2) also known as core-binding factor subunit alpha-1 (Cbfa1) is the first transcription factor involved in mesenchymal stem cell differentiation into osteoblastic lineage. It also bind to the promoter or enhancer sequence of several bone matrix protein genes includingSpp1 (encoding for OPN) and Bglap (encoding OCN) and thus acting as a master regulator required for bone development. Osterix is another transcription factor required for osteoblastic differentiation21. In osterix-null mice no bone formation occurs suggesting that osterix act downstream Runx-2.
22 Runx 2 expressions has been identified in calcifying aortic SMC and atherosclerotic specimens.23 H2O2 induced VSMC calcification was associated with an increase in mRNA and protein level of Runx2.24 Moreover VSMC Runx-2 expression was indispensable for inducing arterial medial calcification by vitamin D.25OPN also known as bone sialoprotein 1(BSP-1) is a multifunctional acidic non-collagenous bone matrix protein secreted by the osteoclast and osteoblast.
It is present in human plasma, serum, breast milk and urine.OPN is a cytokine released by macrophages, neutrophils, and dendritic cells which increase INF-? and IL-12 level of expression and is important for Th1 cells activity.26 During normal bone mineralization, OPN release is induced and function in inhibition of HA formation. It also functions in linking osteoclasts and osteoblasts to matrix proteins in bone.27 OPN plays important pathological roles in several diseases including cancer and cardiovascular calcification. In initial stages of calcification, together with osteocalcin, OPN is not released markedly however its level of expression increases significantly in advanced stages of the disease suggesting that it has no role in initial arterial calcification.
27OCN is the most abundant non-collagenous protein in the bone matrix solely released by the osteoblast.16 Its precise function in bone metabolism is not fully elucidated. It has long been known for its negative role in bone formation and used as a clinical marker for bone turnover. Surprisingly, osteocalcin deficient mice do not suffer from skeletal abnormalities or have a change in bone mineralization or resorption.
28 Matrix Gla Protein (MGP) is a vitamin k-dependent protein expressed in bone and vessels. Together with osteocalcin, MGP has glutamate residues that need to be ?-carboxylated to activate them in a reaction that requires vitamin K. This explains why individuals with vitamin K deficiency are prone to VC. One of the mechanisms proposed to inhibit medial calcification is by chelating calcium ions and inhibiting crystals growth.
An alternative mechanism is binding to BMP-2 and inactivating it, 29 the transcription factor required for osteogenic differentiation rats treated with warfarin develop medial VC and MGP-/- mice suffer from severe calcification30. High doses of vitamin D induce vascular calcification by increasing serum calcium and phosphate, the formation of Fetuin-A mineral complexes in association with a decrease in free serum levels of Fetuin-A or by MGP is downregulation. 9Biomarker Mechanism of action Effect on VCRunx-2,osterix Transcription factor for osteoblast differentiation from mesenchymal stem cell precursor Promotes calcificationOPN Binds hydroxyapatite and blocks its growth, inhibits VSMC mineralization Inhibits VC*OCN Binds strongly apatite and calcium, prevents calcium precipitation Associated with VC*OPG A decoy receptor for RANKL, interferes with RANK/RANKL interaction Inhibit VCSclerostin Inhibits osteoblast mediated bone formation(through inhibition of Wnt signaling) Inhibits VCBMP-2 Promotes osteoblast differentiation Promotes VCMGP Bind calcium crystals and inhibits apatite growth, bind BMP-2 Inhibit VCFetuin-A Bind calcium phosphate and decrease inflammation, inhibits VSMC apoptosis Inhibits VC Table 1: Soluble biomarkers and regulators of calcification313.Physiology of the AortaArteries are blood vessels that carry blood out of the heart and function in delivering oxygenated blood into organs (except for pulmonary artery). Aorta artery is the largest artery in the body originating from the left ventricle from which all arteries in the body originate, except for the pulmonary artery which arises from the right ventricle. Aorta artery consists of three main parts: the ascending aorta, aortic arch and the descending aorta.
Ascending aorta is the part which extends from the left ventricle and from which the coronary arteries branch. The aortic arch is the curved section that connect the ascending and descending parts and from which the subclavian and carotid arteries branch. Descending aorta is the region extending from the arch to the trunk forming thoracic and abdominal aorta.On a narrower scope, the wall of the aorta consists of three distinct layers: the outermost tunica externa (adventitia), tunica media, and the innermost tunica intima. Tunica adventitia is a connective tissue-rich protective layer containing nerve fibers and the vasa vasorum enriching the media with oxygenated blood 32 . Tunica media is the main contractile layer consisting of VSMC alternating between elastin, collagen and other constituents of the extracellular matrix (glycoproteins, proteoglycans).33 The intimal layer is a monolayer of endothelial cells resting on a basement membrane and separated from the medial layer by membrane called the internal elastic intima34.
Different regions of the vasculature are distinguished by their unique physical properties needed to perform their specific physiological functions. For instance, there is a difference in the number of smooth muscle layers in the media and the composition of extracellular matrix between the ascending and descending parts. In fact, it is not only a difference in the physiology but also in the susceptibility to diseases. For example, the aortic arch develops atherosclerotic plaques more than other regions and calcifies more rapidly. Authors hypothesize that this may be due to a combination of the embryonic origin and the vascular environment that account for regional variations in physiology and pathology343.1Artery calcificationArterial calcification is the ectopic deposition of calcium phosphate crystals in the arterial wall. It occurs particularly in conduit arteries such as aorta, coronary, and carotid arteries and peripheral arteries including digital and pedal arteries. However, each one exhibits different pathophysiology relying on structural and functional differences.
Another common site of calcification is the aortic valve and the condition is termed “calcific aortic valvular disease” which has severe complications. Arterial calcification is also possible in small arterioles in the skin leading to localized ischemia.33. The presence of dystrophic calcification in the arterial wall is considered as a repair mechanism in response to injury and a form of scar tissue 35. The process is associated with loss of elasticity, hemodynamic homeostasis, and progressive cardiovascular complications36 As mentioned previously,several diseases are predictors of arterial calcification including atherosclerosis, hypertension, diabetes, and renal diseases(discussed later). Two types of arterial calcification exist: intimal and medial calcification(Figure 2). Intima calcification is a hallmark of atherosclerosis characterized by inflammation, macrophage infiltration, lipid deposition and changes in plaque characteristics 35.
On the other hand, media calcification, also known as M?nckberg sclerosis or media calcinosis is manifested by diffuse mineral deposition in the tunica media35. It is frequently observed in individuals with metabolic disorders such as diabetes mellitus and chronic kidney disease. The clinical outcome of this type is arterial stiffness, increased cardiac post-load, and dysregulation of hemodynamics1. Figure 2: Different types of arterial calcification54.Passive versus active modelVC has been previously considered as a passive degenerative process of mineral precipitation when Pi x Ca product exceeds a certain limit and due to absence of calcification inhibitors such as MGP. However numerous studies have shown that even if the Ca x Pi product was normal vascular calcification still occurs such as in patients with diabetes mellitus4. As such, this view has been abandoned and overwhelming evidences suggest that it is a highly regulated active process that involves the trans-differentiation of vascular smooth muscle cells (VSMC) into an osteo/chondrogenic phenotype and the release of matrix vesicles2). Although passive precipitation of HA crystals may occur in atherosclerotic plaques as a result of chronic inflammation and necrosis37, experimental evidence have shown that in response to particular stimuli VSMC gain the phenotype of an osteogenic cell.
This is further depicted in a study where in vitro culture of VSMC treated with high phosphate concentration resulted in the upregulation of bone specific transcription factors: Runx2, osterix and osteogenic marker TNAP and down regulation of VSMC phenotypic markers: SM22a and a-SMA 38. Therefore, it is crucial to get insight toward the physiological nature of this cell and its unique features enabling it to adopt various phenotypes to deal with environmental changes.5.VSMC plasticityVSMC are key regulators of vascular tone and the main cellular elements of the vascular media2 .
To fulfill this function, they need to have a contractile phenotype and are thus characterized by a number of phenotype-specific markers including SM22a and a-SMA reflecting their function as hemodynamic balance maintainers. These cells are characterized by their huge plasticity with the ability to modulate their phenotype based on the environmental cues 34. In response to injury or stress, VSMC switch from a quiescent contractile phenotype into a migratory, secretory or an osteoblast like phenotype33.
Synthetic VSMC downregulate the expression of genes that are characteristic of differentiated VSMC meeting their contractile function and enhance the expression of others allowing them to adapt varying conditions. For instance, during atherosclerosis, VSMC detach from the basement membrane and migrate toward the intimal layer due to the enhanced production and release of elastolytic enzymes (matrix metalloproteinases) leading to VSMC hyperplasia and contributing to arterial thickening 2.Under specific stimuli such as, increased inflammatory cytokines (Il-6 and TNF-?), oxidative stress and activation of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase modulating downstream reactive oxygen species (ROS) signaling pathways, calcium?phosphate rich diet and hormonal imbalance (Angiotensin II, parathyroid hormone) VSMC trans-differentiate into osteo/chondrocyte like cells and acquires features characteristic of these cells(Figure 3). In an ex vivo study, high phosphate concentration elicit an increase in the expression of Pit-1 in rat aortas compared to vehicle treated, a Na/Pi cotransporter expressed in the osteoblast and required for the process of mineralization and reduce VSMC a-SMA protein 39. The release of MV, the nidus for HA crystal nucleation, from VSMC was previously described as a rescue mechanism for preventing VSMC apoptosis and later discovered as a mechanism ensuing vascular calcification 38.. Figure 3: Mineralizing VSMC elaborate markers of osteo/chondrocyte like cell406.
Causes of VC: 6.1.VC and CKDVC is the major cause of cardiovascular diseases associated with individuals with CKD knowing that it contributes to impaired myocardial function, myocardial ischemia and several other complications41. In addition to the disturbed mineral balance in these individuals (discussed later), decreased plasma concentration of several inhibitors of calcification such as Fetuin-A and PPi has been reported. Chronic kidney disease is the condition manifested by the gradual loss of the kidney function. Kidneys perform vital roles including waste excretion, water level balancing, blood pressure regulation, and mineral homeostasis.
Mineral homeostasis is maintained by the interplay of three organ systems: kidneys, bone, and intestine. Of interest in this manuscript, phosphate and calcium are regulated by variety of hormones and growth factors including PTH, vitamin D metabolites, FGF-23 42.High levels of PTH function in bone resorption resulting in decreased osteoblast proliferation and osteoclast activation releasing calcium (Ca) and phosphate (P).At the level of the kidneys, PTH reduce Ca reabsorption but stimulate that of P along with FGF-23. The active form of vitamin D 1, 25(OH) 2D3 stimulates intestinal and phosphate absorption.
42One of the complications associated with the progression CKD is hyperphosphatemia caused by reduced renal excretion of phosphate. Elevated blood level of phosphate induces FGF-23 production which functions in inhibiting Cytochrome P27B1 (CYP27B1); the enzyme required for the generation of the active form 1, 25 (OH) 2D3 thus reducing calcium intestinal absorption. High levels of P with low levels of Ca and vitamin D induce PTH hormone production which normally enhances P excretion however in individuals with renal failure; the kidneys are not able to function properly. This will make the situation more complicated and thus PTH now recruit Ca from the bone together with phosphorus leading to increased plasma concentration of Ca and maintaining high blood levels of phosphorus favoring VC 41.
The correlation of CKD with ectopic calcification and more precisely medial aortic calcification has been further emphasized by the use of animal models including remnant kidney rats fed with high phosphorus and 1,25(OH)2D3 diet or adenine induced CKD rat model on a low protein diet. These animal models are also used to assess the therapeutic efficacy of various drugs used for the treatment of VC in CKD patients including phosphate binding agents and calcimimtics41.6.2.
VC and DiabetesNumerous studies in the past 20 years have shown a strong tight relation between hyperglycemia, impaired insulin signaling and vascular pathology43. Diabetes is a predisposing factor for VC and a strong predictor of cardiovascular disease. Individuals with diabetes show increased expression of bone-related proteins in their vessels such as BMP, collagen type I and TNAP compared to non-diabetic subjects. In diabetic patients, medial VC occurs in coronary arteries and arteries of the lower limbs and act as future predictors of cardiovascular related diabetic complications such as stroke and lower limb amputations. Several mechanisms may be involved in the vulnerability to VC1. High glucose induces ROS release which are upstream regulators of complex molecular networks leading to endothelial dysfunction and contribute hugely to the trasndifferentiation of VSMC into osteogenic phenotype.
ROS upregulate the expression of NF-?b and protein kinase C (PKC). PKC-ß2 isoform is highly detected in diabetic patients and function in ROS accumulation in mitochondria and further production by NADPH oxidase43.Advanced glycation end products (AGEs) are extensively sugar-modified proteins considered potential biomarkers of cardiovascular complications in diabetic patients. These are associated with oxidative stress and the release of inflammatory cytokines IL-8 and MCP-1 as well as MMP- 9 suggesting their role in arterial remodeling 43. It has been shown that their receptors are co-localized with VSMC undergoing osteo/chondrogenic differentiation in rodents with diet-induced diabetes. A recent study identified a new population of mononuclear cells expressing OCN and TNAP called myeloid calcifying cells (MCCS) producing spotty areas of calcification and are over presented in patients with type II diabetes.Another mechanism may be the inhibition of vitamin k dependent activation of the inhibitor of calcification MGP.
A study on 198 patients having type II diabetes with normal or slightly altered kidney function demonstrate a positive association of plasma dephosphorylated uncarboxylated MGP (dp-ucMGP) and peripheral arterial calcification 44.Diabetic mice and rats show an increase in aortic BMP activity that was associated with increased calcium accumulation. Similar results were observed in human aortic endothelial cells receiving high glucose concentration suggesting a role for vascular cells in osteogenic activation 1.Diabetes and its associated complications represent a suitable milieu for the development of VC and despite the great progress in preventive strategies and pharmacotherapy; cardiovascular diseases remain the major cause of mortality in patients with T2DM. Recently, scientists are focusing on epigenetic mechanisms including DNA methylation and miRNA profiles that are disturbed and linked to cardiovascular phenotype.6.3.
VC and AtherosclerosisAtherosclerosis is an inflammatory disease characterized by theaccumulation of lipids, infiltration of inflammatory and immune cells, and the deformity of thearterial wall. Atherosclerotic lesions or atheroma are asymmetric focal thickening of the arterial innermost layer, the intima, which develop in response to endothelial injury. Calcification is a prominent feature of atherosclerotic lesions especially in advanced stages36.
It has been estimated that 70% of atherosclerotic lesions are calcified. In apolipoprotein-E deficient (Apo E-/-) mouse model of atherosclerosis, and in the absence of VSMC specific Runx-2, plaque calcification was inhibited. Inflammation and oxidative stress induced during atherosclerosis play a major role in plaque calcification. ROS oxidize LDL to be internalized by macrophages forming lipid laid macrophages or foam cells amplifying the inflammatory response.
The process is associated with various cellular and molecular responses by which recruited macrophages and other leukocytes release growth factors, cytokines and other mediators. These induce multiple effects including VSMC differentiation from contractile phenotype into synthetic proliferative phenotype, VSMC migration and proliferation, and extracellular matrix deposition33. Various mechanisms underlie the vulnerability of atheroma for calcification. Studies demonstrate that cholesterol and lipid rich deposit accumulation as well as vesicles derived from dead cells act as nucleation sites for hydroxyapatite deposition. Macrophages and mast cells localized within atherosclerotic plaque in different developmental stages release tryptase which is a proteinase implicated in tissue remodeling, fibroblast and epithelial cells proliferation and collagen synthesis45. Moreover, cholesterol induce the expression of TNAP and stimulate mineralization possibly through ER stress or modulating membrane dynamics leading to MV release. Fatty acids (FAs) appear to play an important role in atherosclerotic plaque calcification. Saturated FAs particularly palmitate and stearate, are known to stimulate VSMC trans-differentiation through endoplasmic reticulum(ER) stress upon phosphatidic acid generation.
However unsaturated FAs appear to inhibit calcification and thus omega 3 FAs are efficient for atherosclerosis treatment, since in addition to their role in reducing inflammation they are effective in inhibiting calcification via activating peroxisome proliferator-activated receptor-? (PPAR-?) 36.6.4.VC and HypertensionBlood pressure is the force of blood pushing the walls of the arteries as it flows through them. Hypertension is a long-term medical condition of persistently elevated blood pressure.
It is a strong predictor of cardiovascular disease and intimately linked to vascular calcifications, vasoactive agents have been described as modulators of VC38, 46. Hypertension acts as a cause or effect in different types of calcification. Historically, it was considered as a major risk factor for atherosclerosis and has been linked to intimal calcification. However, medial calcification and hypertension potentiate each other. As elaborated in previous sections, medial calcification decreases the elasticity of the media which results in arterial stiffness that accelerate the pulse wave velocity leading to hypertension38.Hypertension is responsible for structural and functional vascular alterations that are influenced by many humoral factors of which Ang II seems to be critical47. Ang II regulates the vasomotor tone through its potent vasoconstrictor property, it also affects VSMC proliferation and migration and influence cell growth and apoptosis.
Studies on animal models of medial calcification have demonstrated that anti-hypertensive treatment such as Ang II blockers have the ability to slow or prevent medial calcification38.6.4.
1RASRAS is an endocrine system involved directly in regulating blood pressure directly acting on blood vessels and indirectly by stimulating salts and water reabsorption upon acting on the adrenal gland. RAS plays a major physiological role in regulating vascular function and further exerts a pathological role during vascular injury through its action on endothelial cells, vascular inflammation and remodeling48. Drugs that inhibit RAS reduce the risk of cardiovascular events and promote vascular health. Circulating renin produced primarily by the kidneys convert angiotensinogen derived from the liver into Ang I which is then cleaved by Angiotensin converting enzyme (ACE) to yield Ang II. Recent data suggest that renin is not only produced from the kidney and Ang along with its derived peptides production is not restricted to renal tissues rather they were found in other organs including the brain, pituitary gland, heart and vessels. In these organs, the system is referred to as local or tissue-based and its activity is elevated in variety of diseases such as diabetes, retinopathies, and cardiovascular diseases49.
6.4.2.Ang II receptors and signalingAng II mediates its effects via complex interaction with the two G-protein coupled receptors Angiotensin type I receptor (AT1R) orAngiotensin type 2 receptor (AT2R).AT1R mediates the pathophysiological effects of Ang II including vasoconstriction, inflammation, fibrosis and growth, however AT2R oppose AT1R-mediated actions thus promoting vasodilatation and apoptosis48.
Binding of Ang II to its receptor AT1R results in the coupling of G proteins with the C terminal of the receptor leading to activation of multiple signaling pathways including phospholipase D (PLD), phospholipase C (PLC), Ca2+ channels, serine threonine kinases including MAP kinases and protein kinase C (PKC) and NADPH oxidase48. Activation of PLC produces inositol-1, 4, 5-triphosphate (IP3) and diacylglycerol (DAG) within seconds. IP3 binds to its receptor on sarcoplasmic reticulum, opening Ca2+ channel that allows calcium efflux into the cytoplasm. Ca2+ binds to calmodulin and activates myosin light chain kinase (MLCK) enhancing the interaction between actin and myosin, causing SMC contraction.
Myosin light chain phosphatase (MLCP) counter-regulate MLCK, and is inhibited by Rho kinase and thus vascular injury and hypertension are associated with increased activation of RhoA/Rho kinase activity50. PLD activation leads to PC hydrolysis into phosphatidic acid(PA) and choline.PA is converted into DAG sustaining contraction.
The PLC/PLD pathways are augmented in hypertensive rats compared to control suggesting a role for their downstream signaling second messengers in the pathogenesis of hypertension50.6.4.3.Ang II signaling through reactive oxygen speciesMany of the molecular and cellular effects of Ang II are mediated through the production of ROS. Of the various species generated: superoxide anion (•O2-), hydrogen peroxide (H2O2), and nitric oxide (NO) appear to be important in cardiovascular system48. Vascular ROS are produced in the endothelium and VSMC from non-phagocytic NADPH oxidases (Nox 1, 4, 5).
These are constitutively active and released ROS act as intracellular signaling molecules that activate transcription factors and other molecules involved in migration, inflammation, and fibrosis. Ang II is a potent stimulator of NADPH oxidase and stimulates the expression of its subunits. In several pathologies including atherosclerosis, diabetes and hypertension these processes are augmented consequently leading to oxidative stress51.•O2- and H2O2 activate multiple signaling molecules including tyrosine kinases, tyrosine phosphatases, MAP kinases, calcium channels and transcription factors including NF-?B and Activator protein 1(AP-1)52.
Once activated, these molecules participate in cell growth, contraction, production of extracellular matrix proteins, and expression of pro-inflammatory genes all contributing to vascular injury48. In Ang II hypertensive rats; treatment with superoxide dismutase (SOD) mimetics reduce the release of vascular ROS and regress vascular remodeling47. Clinical studies suggest an antioxidant effect of AT1R blockers as hypertensive patients show reduced inflammation and oxidative stress when treated with candesartan48.
6.4.4.Ang II, vascular remodeling and calcificationVSMC as mentioned previously are highly plastic cells that contribute to arterial remodeling by affecting cell growth, apoptosis, inflammation and fibrosis.
Ang II promotes phenotypic switching from a contractile phenotype to a secretory phenotype by influencing the contractile machinery, cell hypertrophy and proliferation, and the secretion of mitogenic, inflammatory and fibrotic mediators48(Figure 4).VC is one of the complex processes that involve arterial remodeling and the trasndifferentiation of VSMC into osteoblast-like cells. Ang II influences largely numerous events that induce VC. It stimulates the expression of master regulators andtranscription factors of osteogenic differentiation such as BMP-2 and Runx-2. In addition, Ang II reduces the expression of inhibitors of calcification such as MGP53.
Moreover, Ang II stimulates the expression of lectin like oxidized LDL receptor-1 (LOX-1) that is expressed at the surface of endothelial cells and VSMC. The interaction between the oxLDL and LOX-1 enhances the production of inflammatory cytokines from VSMC and the production of fibrous cap present in advanced atherosclerotic plaques that frequently become calcified48.Arterial calcification was inhibited in rabbits fed with atherogenic diet then treated with AT1R blocker olmesartan medoxomil46.
In addition Losartan inhibits VC in a rat model treated with warfarin and vitamin k to induce VC and reduce the mRNA and protein expression of BMP2 and Runx-2 compared to groups with VC who did not receive the drug54.Figure 4: Mechanisms whereby Ang II induces vascular injury.487.AutophagyAutophagy is a self degradative process essential for maintenance of cellular homeostasis via the removal of damaged organelles and misfolded proteins and act as a survival mechanism for cells during nutrient stress thus balancing the sources of energy55. Autophagy starts by the formation of the phagophore membrane of lipid bilayer nature derived from the ER and then the engulfment of the intracellular cargo followed by the fusion with the lysosome so that engulfed materials are sentenced to be degraded by the lysosome acid- hydrolases.
Upon degradation by anabolic pathways, large macromolecules are provided to sustain energy level and to provide raw materials for synthesis of higher ordered structures (nucleic acids, proteins…) 56. Defects in autophagy demonstrate the importance of this process in physiological and pathological conditions and this was proved by Autophagy knockout animal models. For instance, mutations in ATG16L1,an important component of autophagic machinery required for the multimerization of the phagophore membrane, has been linked to the susceptibility to Chron’s disease57.
In addition, Lysosome associated membrane protein 2(LAMP-2) plays an important role in the third type of Autophagy that is chaperone-mediated Autophagy and in the fusion of the phagosome with the lysosome for autolysosme formation. Mutations in the gene encoding this protein lead to genetic lesions in Danon disease that cause cardiomyocyte hypertrophy55. It’s now obvious that disruption in the autophagic flux play either a protective or a destructive role in numerous diseases and drugs interfering with various stages of the process are gaining considerable attention. Autophagy modulating drugs such as chloroquine and Carbamazepine are now in clinical trials577.
1.Autophagy and vascular biologyThere is increasing interest in the role of autophagy in vascular biology as its dysregulation was shown to be associated with a wide array of abnormal vascular processes and pathologies56. Autophagy has widely been characterized in cardiovascular system including cardiomyocytes, endothelial cells, and VSMCs. Optimal autophagic flux is required for the maintenance of cardiac homeostasis as excessive or insufficient levels contribute to heart diseases. A growing body of literature suggests that the loss of autophagy contribute to endothelial dysfunction. Diabetes for instance triggers vascular injury via multiple signaling pathways activated by a high glucose level and by Ang II. In vitro studies demonstrate a protective effect of autophagy from detrimental effects of Ang II and limiting glucose induced endothelial damage58 .
The addition of platelet derived growth factor PDGF to VSMC induce VSMC switching into a synthetic phenotype and induce autophagy. Pharmacological inhibition of autophagy on the other hand, inhibits the effect of platelet derived growth factor (PDGF) on SMC phenotypic switching thus VSMC switching is associated with autophagy. Autophagy modulates SMC biology also in calcification. In vitro TGF-? induced calcification was suppressed by VSMC treatment with atorvastatin upon induction of autophagy56.Aim of the ProjectCardiovascular diseases, such as hypertension, atherosclerosis, and heart failure, are associated with modification in the Renin-Angiotensin-Aldosterone System (RAAS). Regardless of the difference in the nature of the disease, treatment with drugs inhibiting RAAS has been shown to reduce cardiovascular events. Since hypercholesteremia is often associated with hypertension, a large number of patients receive statins in combination with antihypertensive drugs.
Numerous in vivo and in vitro studies suggest that statins boost the efficacy of RAAS inhibitors. Statins exert a wide spectrum of biological effects among which are non-lipid-dependent ones and has been found to ameliorate the Ang II mediated vascular injury by several mechanisms most prominently through reducing oxidative stress and inflammation. Due to the implication of autophagy in cardiovascular physiology and pathology, it is important to determine whether this process act as an inducible or protective mechanism in case of vascular calcification. The aim of the present study is:• To assess the effect of Ang II treatment on vascular calcification after 72 hrs incubation.
• To determine whether statins at this early stage of calcification are able to reduce or inhibit Ang II mediated detrimental effects in the present rat hypertensive model. • To investigate the role of autophagy in statin mediated inhibition of Ang II detrimental effects on vascular injury by adding autophagy inhibitor and observes the progression of vascular calcification.Chapter II: Materials and methods1.Animals and experimental protocolThis study was approved by the Institutional Animal Care and Use Committee (IACUC) of the American University of Beirut (AUB). Male Sprague-Dawley rats weighing 200-250 g were obtained from Charles River Laboratories and maintained in the animal care facility at AUB. 2.
Experimental DesignRats were sacrificed by CO2 inhalation and the aortic arches were isolated and dissected. Arches were cultured in DMEM (Dulbecco’s Modified Eagle Medium) supplemented with 10% FBS, and 5% penicillin/streptomycin. A set of two groups: control and Angiotensin II treated (10-6 µM) were incubated at 37°C in a humidified atmosphere with 5% CO2 for 72 hours. Medium with or without angiotensin was changed every 24 hours.Aortic arches used for histological analysis were embedded in optimal cutting temperature compound (OCT) compound and frozen in liquid nitrogen cooled-isopentane for subsequent cutting by microtome-cryostat into 5?m thickness then stored at -80°C. Arches used for RNA analysis were snap frozen in liquid nitrogen then stored at -80°C.
3.Von kossa stainingFrozen cross sections were stained using the von kossa method to demonstrate deposits of soluble and insoluble calcium salts. Slides were incubated with 5% silver nitrate for 1 hour under the UV light. Unreacted silver was removed with 5% sodium thiosulfate. Slides were counterstained with safranin then dehydrated.
Tissue images were visualized by Laser Microdissection (LMD) microscope (Leica microsystems, Cambridge, UK) at 20x magnification.4.Alizarin Red S Frozen sections were incubated with 1% Alizarin Red S (pH=4.2) at room temperature in dark for 30 min to stain calcium phosphate salts.
Slides were observed by LMD microscope at 20x magnification.5.DHE experimentThe ROS generation in aortic arches was evaluated by the DHE staining method (Calbiochem, Darmstadt, Germany). Dihydroethidium (DHE) is a membrane permeable probe when oxidized leads to the generation of several florescent products among which are 2-hyroxyethidium which is specific for superoxide, and ethidium which is not specific for a particular ROS.
These products intercalates into the DNA and fluoresces red. Briefly, 300?l of 10?M concentrated DHE were applied to frozen aortic arches sections and incubated in a light protected humidified chamber for 30 min at 37°C.Then 12?l of mounting solution (Thermofisher, ProLong™ Gold Antifade Mountant with DAPI) was added. The nuclei of the tissues were stained with DAPI (4′,6-Diamidino-2-Phenylindole, Dilactate), a blue fluorescent nucleic acid stain which bind the minor groove AT clusters, present within the mounting solution.
Slides were then covered with cover slips and left to dry. Images of tissues were taken using Microscope Zeiss Axio (Leica microsystems, Cambridge, UK). Zen was used to quantify the intensity of the Fluorescence of DHE. Control was used as a reference.6.RNA Extraction500 ?L QIAzol (QIAGEN, 79306) was added to the crushed frozen aortic arches and incubated at room temperature for nucleoprotein complex dissociation. 100 ?L chloroform was then added to samples, followed by vigorous shaking for 15 seconds and incubated for 10 min at room temperature. Samples were centrifuged at 12000 x g for 10 min at 4°C.
Three distinct phases were obtained: a lower red organic phase, a white interphase and a colorless aqueous upper phase, the resulting clear supernatant contain the RNA .The aqueous phase was transferred into a new micro-centrifuge tube and RNA was precipitated by 250 ?L isopropanol. The tubes were inverted several times, and then incubated 5-10 min at room temperature. Samples were centrifuged at 12000 x g for 10 min at 4°C and supernatant was aspirated. The pellet was washed with 75 % ethanol and centrifuged at 7500 x g for 5 min at 4°C.
The supernatant was aspirated, the pellet was air dried and resuspended in 20 ?L DEPC water. RNA samples were incubated for 10-15 min at 55-60°C, then allowed to quench on ice. The resulting RNA was quantified using Nanodrop (Thermo Fisher Scientific)7.
Reverse transcription-PCR:1 ?g of total RNA were reversed transcribed(Thermo Fischer Scientific, 00407363) using the RT-PCR machine (Bio-Rad Laboratories, California, USA). The cycle begins at 25°C for 10 min, 37°C for 2 hours, 85°C for 5 min, and ends at 4°C. The cDNA samples were stored at -20°C.
8.Real-Time PCRReal-time PCR reactions were performed using CFX384 system (Bio-Rad Laboratories, California, USA) with iTaq™ Universal SYBR® Green supermix (Bio-Rad Laboratories, California, USA). The plate was run for 56 cycles. The first cycle was run at 94°C for 15 min followed by 55 cycles each at 94°C for 15 seconds, 56°C for 20 seconds, and finally 72°C for 30 seconds.
Melting curves were evaluated to check for primer specificity for the PCR product and the results were quantified and analyzed using the Delta-Delta CT method. The primer sequences are listed in Table 2 .The housekeeping gene 18S rRNA was used for normalization. Target genes Forward primer Reverse primer18S GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCGOsteopontin(OPN) TATCAAGGTCATCCCAGTTGCCC ATCCAGCTGACTTGACTTGACTOsteocalcin(OCN) GGTGCAGACCTAGCAGACACCA AGGTAGCGCAGTCTATTCAIL-6 TTCTCTCCGCAAGAGACTTCC TCTCCTCTCCGACTTGTGAATNF-? ATGGGCTCCCTCTCATCAGT GCTTGGTGGTTTGCTACGACPLD1 TCCCAACTGAGATCTGGACGTAAAGG ACCTGCCTCTCATCTCTGGATCATACACTable 2: List of primers used in qRT-PCR.
9.Statistical analysisExperiments were performed in triplicates and repeated for three independent experiments. Results are expressed as mean±SEM.
Statistical comparisons were performed using the unpaired t-test. The p values for p
