Title pageDrimia maritima induces apoptosis through mitochondrial signaling and endoplasmic reticulum stress in human breast cancer cellsAuthors’ full names:Maryam Hamzeloo-Moghadam1, Mahmoud Aghaei2, Mohammad Hossein Abdolmohammadi3, Amir Khalaj1,4, Faranak Fallahian3Affiliations:1Traditional Medicine and Materia Medica Research Center and Department of Traditional Pharmacy, School of Traditional Medcine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.2Department of Clinical Biochemistry, School of Pharmacy ; Pharmaceutical Sciences, Isfahan University of Medical Sciences, Isfahan, Iran.3Cellular and Molecular Research Center, Qom University of Medical Sciences, Qom, Iran. 4Food and Drug Laboratory Research Center, Food and Drug Organization, MOH ; ME,Tehran,Iran.
Corresponding author:Faranak Fallahian Ph.D., Cellular and Molecular Research Center, Qom university of Medical Sciences, Qom, Iran. Tel: +98 (25) 37831370, Fax: +98 (25) 37831370.E-mail: [email protected] AbstractAfter survey on the historical Pharmacopoeia of Iranian Traditional Medicine (ITM) and medicinal plants which had been used to manage cancer-like disorders, Drimia maritima (D.maritima) has been subjected to investigate it’s in vitro anticancer properties.
The effects of D.maritima on proliferation and tumor progression have not been reported yet. Therefore, the present study was designed to investigate the anticancer features of D.maritima as well as its possible molecular mechanisms of action in two breast cancer cell lines, MCF7 and MDA-MB-468 cell lines. D.
maritima was found cytotoxic against MCF-7 and MDA-MB-468 cells with IC50 value of 20.48±1.17 µM and 25.74±2.
05 µM, respectively. Flow cytometric analysis showed that D.maritima induced apoptosis that was associated with production of ROS, loss of mitochondrial membrane potential (??m) and increasing Bax/Bcl-2 ratio. Furthermore, we investigated the effects of D.maritima on unfolded protein response (UPR) genes. We found that D.maritima dose dependently increased the mRNA expression of CHOP, ATF-4, GADD34 and TRIB3 in MCF-7 and MDA-MB-468 cells.
Our results suggest that D.maritima is an effective apoptosis inducing agent for MCF-7 and MDA-MB-468 cells that exerts its inhibitory function through ER stress and mitochondrial mediated apoptotic pathways.Keywords: Drimia maritima; Apoptosis; ER stress; Mitochondria; Breast cancer1. IntroductionBreast cancer is the most common type of cancer and the leading cause of cancer mortality among women, especially in western populations and industrialized countries. Despite advances in treatment using surgery, chemotherapy, and radiation therapy, many women with breast cancer continue to die of this malignancy 1. The major problems concerning conventional therapeutic strategies are the occurrence of undesired and severe side effects induced by the non-specific targeting of both normal and cancer cells 2.
Therefore, discovery of naturally plant products with low toxicity have attracted considerable scientific interest in the recent years.The Endoplasmic reticulum (ER) is a central organelle plays an essential role in protein synthesis, lipid synthesis, Ca+2? homeostasis, protein folding, and controlling cell homeostasis 3. However, some conditions such as hypoxia, oxidative stress, failure of protein synthesis, protein misfolding, and Ca2+ overload can impair ER homeostasis and lead to ER stress-related events 4.
To alleviate the deleterious effects of ER stress, cells have evolved various protective strategies, collectively termed the unfolded protein response (UPR). The UPR is a complex pathway that is mediated by activation of three transmembrane proteins: inositol requiring enzyme 1 (IRE1), PKR-like ER kinase (PERK) and activating transcription factor 6 (ATF6) 4,5. The expression of these proteins is up-regulated to reduce ER overload to protect cells against ER stress. However, when this ER stress response fails to restore ER homeostasis, apoptosis is triggered via several different mechanisms 6.Apoptosis, a crucial mode of programmed cell death, is one of the first-line defenses in multicellular organisms to stop tumor development 7. Apoptosis provides a physiologic protective mechanism for eliminating genetically damaged cells, initiated cells or cells progressed to malignancy, therefore phytochemicals affecting apoptosis can have an important effect on carcinogenesis 8.
In recent years, drugs derived from natural products targeting apoptotic pathways have been explored for cancer therapy as well as chemoprevention. Drimia maritima (D.maririma) belongs to the Asparagaceae family and is widely distributed in Mediterranean area, Africa, Iran and India 9. Cardiac glycosides are the main constituents isolated from this plant. Moreover, phenolic compounds, phytosterols and other phytochemical constituents were identified in these plants 9.
D.maririma has been used in Iranian Traditional Medicine (ITM) considering cancer and cancer related disorders 10. However, a literature survey reveals that the anticancer properties of D.maritima remain largely unexplored 9,11. Accordingly, we conducted the present study to investigate the potential anticancer properties of D.maritima and its underlying molecular mechanisms in two human breast cancer cell lines, MCF-7 and MDA-MB-468. 2. Materials & methods2.
1. Reagents and chemicalsRPMI 1640, Fetal Bovine Serum (FBS), Trypsin-EDTA, Penicillin-Streptomycin, and MTT were obtained from Gibco (Rockville, USA). AnnexinV-FITC apoptosis detection kit and Caspase-6 colorimetric assay kit was bought from Biovision (Mountain View, CA). Fluorescent Reactive Oxygen Species detection kit was obtained from Marker Gene Technologies (MGT, Inc., USA).
The antibodies against BAX, Bcl-2 and Cytochrome C were obtained from Santa Cruz (Santa Cruz, CA, USA). 2.2.
Preparation of D. maritima extract D. maritima bulbs were collected from Kohgiluyeh va Boyer Ahmad Province, Iran (2015). The scientific name was authenticated by Dr. Hamid Moazzeni Zehan, Traditional Medicine and Materia Medica Research Center, Shahid Behehshti University of Medical Sciences, Tehran, Iran. A voucher specimen (TMRC 3722) was kept for future reference.
For preparing the methanol extract, 10 mg of powdered shade dried D. maritima bulbs were macerated with methanol (1:10) for thrice. The solvent was refreshed every 24 h and the filtrates were combined and evaporated to dryness under reduced pressure in a rotatory evaporator. The extract was dissolved in DMSO (sigma), sterilized by filtration and subsequently diluted to appropriate working concentration.2.
3. Cell line and culture condition The MCF-7 and MB-MDA-468 human breast cancer cell lines were obtained from the Pasteur Institute of Iran. Cells were cultured in RPMI-1640 supplemented with 10% FBS, 100 U/ml of penicillin and 100 ?g/ml of streptomycin, and incubated at 37?C, 5% CO2 and 95% humidity. 2.
4. Evaluation of cell proliferation by MTT assayCytotoxicity of D.maritima against MCF-7 and MDA-MB-468 cancer cells was estimated by the 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay, based on the reduction of the MTT by mitochondrial dehydrogenases in viable cells. MCF-7 and MDA-MB-468 cells were seeded in a 96-well plate at a concentration of 5 × 103 cells/well and incubated at 37°C for 24 h.
After that, cells were treated with tested extract at concentrations ranging from 0.1- 1000 ?g/ml for 48 h. At the end of treatment, 20 ?l of MTT solution (5mg/mL in PBS) was added to each well and further incubated for 4 h. Thereafter, medium containing MTT was gently replaced by 200 ?l DMSO and the absorbance values were measured by a microtiter plate reader (Biotek ELx800 – MS) at 540 nm with a reference wavelength of 630 nm. 2.
5. Apoptosis assay by flow cytometryApoptosis in MCF-7 and MDA-MB-468 cells was detected using Annexin V-fluorescein isothiocyanate (FITC)/ Propidium iodide (PI) apoptosis detection kit following the manufacturer’s instruction. Briefly, cells were plated in a 6-well culture plate and then incubated with or without indicated amount of extract. Following 48 h incubation with the extract, the percentage of apoptotic cells was determined by the Annexin V-FITC/PI assay. The cells were harvested, washed with cold phosphate-buffered saline and suspended in a binding buffer, and incubated with Annexin V-FITC for 10–15 min in the dark.
PI was then added and the cells were incubated again for 15 min in the dark. The stained cells were then analyzed by flow cytometry using FACS Calibur instrument (Becton Dickinson, USA) and CellQuest software (BD Biosciences, San Jose, CA, USA). 2.6.
Quantitative real-time RT-PCRThe total RNA of the MCF-7 and MDA-MB-468 cells were extracted using Trizol reagent (Invitrogen Life Technologies, USA) after treatment with 1, 10 and 100 ?g/ml of D.maritima for 48 h. Total RNA was treated with DNase and then reverse transcribed into first-strand cDNA in a 20 ?l reaction volume using Revert Aid M-MuLV Reverse Transcriptase, according to the manufacturer’s protocol (Fermentas, Leon-Rot, Germany).
Real-time PCR (qPCR) of cDNA was performed using the Step one plus ABI system (Applied Biosystem). Real-time PCR reactions was done in triplicate using 2X SYBR Green PCR Master Mix (ABI, USA) according to the manufacturer’s protocol. The following primers were used: GAPDH, forward 5?- CATGAGAAGTATGACAACAGCCT-3? and reverse 5?- AGTCCTTCCACGATACCAAAGT-3?; ATF4, forward 5?- GCCAAGCACTTCAAACCTCA -3? and reverse 5?- TCCTCCTTGCTGTTGTTGGA -3?; CHOP, forward 5?- AGCCACTCCCCATTATCCTG -3? and reverse 5?- CCAGAGAAGCAGGGTCAAGA -3?; GADD34, forward 5?- CAGAAAGGTGCGCTTCTCC -3? and reverse 5?- AAGGCAAGGTCTGGGTGA -3?, TRIB3, forward 5?- GGACATGCACAGCCTGGT -3? and reverse 5?- GCTTCTTCCTCTCACGGTC -3?. Relative expression levels of genes were normalized to GAPDH and relative quantification values were determined by using the comparative CT method. 2.7. Western Blot analysisMCF-7 and MDA-MB-468 cells were harvested at 4°C in a lysis buffer (20 mM Tris–HCl, 0.
5% Nonidet P-40, 0.5 mM PMSF, 100 mM b-glycerol 3-phosphate, and 0.5% protease inhibitor cocktail) and disrupted by sonication and centrifuged. Equal amounts of total protein were separated on SDS–PAGE gels and transferred to a PVDF membrane (Millipore, Bedford, MA, USA). After blocking with 5% non-fat dry milk in PBS containing 0.1% Tween-20 (PBST) for 1 h at room temperature, the membranes were incubated overnight at 4°C with the monoclonal antibodies against the following proteins; Bax, Bcl-2 and Cytochrome C. The membrane were washed with PBST and incubated with corresponding secondary antibodies for 1 h at room temperature.
Membranes were again washed with PBST and visualized by enhanced Chemiluminescence (ECL) detection reagent (Amersham Corp., Arlington Heights, IL). GAPDH was used as a control for normalization. The software ImageJ (National Institutes of Health, USA) was employed for optical density measurement.
2.8. Caspase-6 activity assayCaspase-6 activity was assessed according to the manufacturer’s instructions for the Caspase-6 Colorimetric Assay Kit (R&D systems). Briefly, cells were harvested and lysed in lysis buffer on ice for 10 min and then centrifuged at 10,000 g for 1 min.
After centrifugation, the supernatants were incubated with caspase-6 substrate in reaction buffer. Samples were incubated in a 96-well flat bottom microplate at 37°C for 1 h. The amount of p-nitroaniline released was measured using a Microplate Reader (Bio-Rad) at a wavelength of 405 nm.2.9. Intracellular reactive oxygen species (ROS) detectionThe reactive oxygen species (ROS) were detected by the Marker Gene TM (MGT) live cell fluorescent ROS detection kit.
Briefly, cells were plated to a density of 25 ×103 per well in 96-well plate and incubated with different concentrations of D.maritima for 48 h. After treatment, cells were further incubated with 20 µM DCFH-DA (2´,7´-dichlorofluorescin diacetate) for 30 min in the dark. Subsequently, cells were harvested and washed with HBSS and analyzed for DCF fluorescence by a Synergy HT Multi-Mode Microplate Reader (BioTek Instruments).
2.10. Measurement of mitochondrial membrane potential (??m) Mitochondrial membrane potential (??m) was assessed by JC-1 (5,5?,6,6?-tetrachloro-1,1?,3,3?-tetraethylbenzimidazol-carbocyanine iodide). In non-apoptotic cells with intact mitochondria, JC-1 selectively enters the mitochondria where it aggregates and exhibits a fluorescence emission at 590 nm. During loss of mitochondrial membrane potential which features dying or apoptotic cells, JC-1 diffuses throughout the cell and exhibits a green fluorescence emission at 530 nm. The ratio between green and red fluorescence provides an estimate of ??m that is independent of the mitochondrial mass.
Following 48 h exposure to D.maritima, culture medium was removed and cells were exposed to culture medium containing JC-1 (3 µM) for 30 min at 37°C. Red/green fluorescence was measured using a Synergy HT Multi-Mode Microplate Reader (BioTek Instruments) that allows for the sequential measurement of each well at two excitation/emission wavelength pairs, 490/540 and 540/590 nm.2.11. Statistical analysisThe results of quantitative studies are reported as mean ± SD.
IC50 value was determined using Graphpad Prism5 software. All experiments were repeated at least three times. To compare data, One-way analysis of variance (ANOVA) with Dunnett’s post-hoc test was used. In all cases, P ; 0.05 was taken as the level of significance.3. Results3.
1. Inhibitory effect of D.maritima on breast cancer cellsTo assess the antiproliferative effect of D.maritima on MCF-7 and MDA-MB-468 cell lines, the MTT assay was conducted. As shown in Fig.1, D.maritima showed impressive dose-dependent inhibition effects on the viability of MCF-7 and MDA-MB-468 cells. Half-maximal inhibitory concentration (IC50) values are commonly used to evaluate the potency of a compound, in which the lower the IC50 value, the more potent the compound is.
The IC50 values for treatment of MCF-7 and MDA-MB-468 cells by D.maritima were 20.48±1.
17µg/ml and 25.74±2.05µg/ml, respectively.
3.2. D.
maritima induced apoptosis in breast cancer cells Induction of apoptosis by D.maritima was quantitatively determined by Annexin V-FITC and PI fluorescence staining. Treatment of MCF-7 and MDA-MB-468 cells with D.maritima (10,100 and 500 µg/ml) significantly increased the percentage of Annexin V-staining positive cells (total apoptotic cells) as compared to the control (Fig.2). In MCF-7 cells, the percentage of apoptotic cells increased from 2.6% in the control to 75.
8% in the 500 µg/ml D.maritima (Fig.2a). In MDA-MB-468 cells, an increased proportion of apoptotic cells from 1.5% in the control to 81.9% in the 500 µg/ml D.maritima-treated cells were observed (Fig.
2b).3.3. D.maritima regulated the expression of apoptotic proteinsGiven the profound roles of the Bcl-2 family in triggering apoptosis, the anti-apoptotic protein Bcl-2 and the pro-apoptotic protein Bax in D.maritima-mediated apoptosis were studied in MCF-7 and MDA-MB-468 cells. The Western blot analysis data showed that the expression of Bcl-2 was noticeably decreased in response to D.
maritima treatment, while the expression of Bax protein was increased (Fig.3). The Bax/Bcl-2 ratio increased in both cell lines, suggesting that these proteins are involved in D.maritima-induced apoptosis. Moreover, Western blot analysis was employed to examine the level of cytochrome C inside the cytoplasm. It was revealed that translocation of cytochrome c from mitochondria to cytosol was increased after D.maritima treatment.
These results suggest that D.maritima treatment induces apoptosis in MCF-7 and MDA-MB-468 cells via activation of mitochondrial pathway.3.
4. Involvement of caspase-6 in D.maritima -induced apoptosisTo examine the contribution of caspases in the D.maritima-induced apoptosis, the activity of caspase-6 was investigated using the colorimetric assay kit. The results demonstrated that treatment of the MCF-7 and MDA-MB-468 cell lines with the various concentration of D.
maritima resulted in a significant increase in the activity of caspase-6 in a dose-dependent manner (Fig.4). 3.
5. D.maritima induced ROS generation in breast cancer cellsMolecules of ROS are involved in the redox-dependent regulation of various cellular functions.
In particular, excessive production of ROS can lead to cell death through apoptosis pathway.To test whether D.maritima have the ability to activate ROS production in cancer cells, we employed the fluorescent ROS detection kit to determine ROS levels in MCF-7 and MDA-MB-468 cells. As shown in Fig. 5, the level of intracellular ROS was increased significantly in a dose-dependent manner after exposing the cells to D.maritima.3.6.
D.maritima reduced the Mitochondrial Membrane Potential (??m) in breast cancer cellsBecause mitochondrial permeability transition is an important aspect in the induction of apoptosis, the decrease in the mitochondrial membrane potential is a hallmark for apoptosis. Therefore, we performed JC-1 staining to investigate the changes in the mitochondrial membrane potential (??m).Results show that the proportion of MCF-7 and MDA-MB-468 cells with loss of mitochondrial membrane potential was increased after exposing cells to D.maritima (Fig.6).
This result suggests that D.maritima causes depolarization of mitochondrial membrane potential which could be linked with the induction of apoptosis in breast cancer cells.3.7. D.maritima induces pro-apoptotic endoplasmic reticulum (ER) stress signaling pathwayTo further elucidate the molecular mechanisms underlying D.maritima–induced apoptosis, we investigated the effects of D.
maritima on unfolded protein response (UPR) genes. The mRNA expression levels of ER stress-associated molecules ATF4 (Activating Transcription Factor 4), CHOP (C/EBP Homologous Protein), GADD34 (Growth Arrest and DNA damage-inducible 34) and TRIB3 (tribbles-related protein 3) were evaluated by real-time PCR.ATF4 is a transcription factor regulating a variety of responses including antioxidant gene expression, amino acid synthesizing enzymes and proapoptotic machinery 12. CHOP, whose induction strongly depends on ATF4, is the major protein involved in apoptotic signals induced by ER stress 6.
Studies examining the mechanism of CHOP-induced apoptosis identified numerous target genes including GADD34 and TRIB3 13,14. D.maritima induced the expression of all tested genes 48 h after treatment in both breast cancer cell lines (Fig.7). The highest increase was detected in CHOP, where 42-fold and 35-fold increase was detected with 100 ?g/ml of D.maritima in MCF-7 and MDA-MB-468 cells, respectively. CHOP overexpression may suggest that in D.maritima treated cells the UPR progressed to a state where homeostasis cannot be restored and the cells are committed to an apoptotic fate.
4. DiscussionNatural products with anticancer therapeutic potential have gained great attention due to their favorable safety and efficacy profiles. A wide variety of natural products with anticancer properties have been reported in the literature. The drug discovery of novel natural products with antitumor activity usually starts with a screening for plant extracts and then move towards identification of their effective compounds 15.Induction of cell apoptosis and regulation of apoptosis-inducing pathways have been an effective strategy for cancer therapy. Two main apoptotic pathways include the intrinsic mitochondrial- and extrinsic death receptor-mediated pathways. The key event of the mitochondrial apoptotic pathway is the loss of mitochondrial membrane potential (??m) and subsequently the release of cytochrome c from the mitochondria into the cytosol 16,17. Cytochrome c and the Bcl-2 family of proteins are important regulators of mitochondria-mediated apoptosis and caspase activation 17, 18.
The Bcl-2 family is subdivided into pro- and anti-apoptotic proteins that can be classified by the presence of one or more BH domains. Under stress conditions anti-apoptotic Bcl-2 proteins are functionally suppressed. Adversely, pro-apoptotic Bcl-2 proteins, such as Bax and Bak, trigger increased permeability of the mitochondrial outer membrane. This creates pores, which allow the release of pro-apoptotic mitochondrial proteins into the cell cytoplasm 16.To elucidate the effect of D.maritima in the induction of apoptosis in MCF-7 and MDA-MB-468 cells, we used flow cytometry after combined staining with Annexin V and PI, which is the most reliable and advanced method for detecting apoptotic cells.
Analysis of treated cells revealed that D.maritima promotes a significant level of cell death via the apoptotic pathway. In addition, western blot analysis also showed that D.maritima induced pro-apoptotic protein (Bax) upregulation, anti-apoptotic protein (Bcl-2) downregulation, and cytochrome c release. Some anticancer agents inducing apoptosis in cancer cells are associated with a rapid collapse of mitochondrial membrane potential (??m) 18.
Our results clearly showed that D.maritima treatment decreased mitochondrial membrane potential (??m) as measured by JC-1 fluorescent dye. Mitochondrial depolarization induces cytochrome c release into the cytoplasm where it activates caspases. To determine the caspase activation during the apoptosis induced by D.maritima, we perused the level of caspase-6 activation by prepared assay kit.
The results exhibited the considerable increase in the level of caspase-6 activity in treated MCF-7 and MDA-MB-468 cells by D.maritima.Many anticancer agents induce apoptotic cell death by their pro-oxidant properties, which increase ROS generation or abrogate the cellular antioxidant systems 19. Our results indicated that the intracellular ROS levels were significantly increased in MCF-7 and MDA-MB-468 cells treated with D.maritima.
Besides the involvement of ROS in the promotion of apoptosis, ROS represent a critical signal for induction of ER stress 20. ER stress triggers an adaptive program called unfolded protein response (UPR) representing a signal induction for cell death in the case of prolonged ER stress 4,6. Under prolonged ER stress, transmembrane ER protein kinase (PERK) activation represents one of the signals that initiate UPR.
PERK phosphorylates eIF2? and consequently attenuates global protein translation but increases translation of Activating Transcription Factor 4 (ATF4). ATF4 in turn induces the expression of CHOP a transcription factor involved in ER stress-mediated apoptosis. During ER stress, all three arms of the UPR induce transcription of CHOP. However, the role of PERK–eIF2?–ATF4 branch of the UPR is essential in the upregulation of CHOP 4-6.Studies examining the mechanism of CHOP-induced apoptosis identified numerous target genes including GADD34, TRIB3, and Bcl-2 6.GADD34 is a protein phosphatase 1 (PP1)-interacting protein that causes PP1 to dephosphorylate eIF2? and thus release the translational block 21.
Expression of GADD34 correlates with apoptosis induced by various signals, and its overexpression can initiate or enhance apoptosis 21. TRIB3 is another gene induced by CHOP 14,23. It has also been demonstrated that up-regulation of TRIB3 is one of the major mechanisms involved in ER stress-induced cell death via the ATF4-CHOP pathway 14. The most studied mechanism of cell death induced by CHOP is the regulation of the levels of several Bcl-2 family members.
Under ER stress, CHOP down-regulates the expression of Bcl-2, sensitizing cells to apoptosis 24. Additionally, the up-regulation of some pro-apoptotic components of the Bcl-2 family, known as BH3-only proteins, such as Bax is observed 6. In the present study, the effect of D.maritima on ER stress was investigated by focusing on the ATF4-CHOP pathway.
We found that D.maritima dose dependently increased the mRNA expression of ATF-4, CHOP, GADD34 and TRIB3 in MCF-7 and MDA-MB-468 cells. In addition the western blot analysis indicated the upregulation Bcl-2 and downregulation Bax in D.maritima treated cells. According to the obtain results, we demonstrated for the first time that D.maritima decreased breast cancer cell viability by inducing intrinsic apoptosis dependent on increase of ROS production and ER stress.5.
Conclusions Collectively, our results support the hypothesis that the mitochondrial pathway and ER stress are involved in apoptosis induced by D.maritima in breast cancer cells. Therefore, our findings provided an insight into understanding the molecular mechanisms of D.maritima which appears to be an interesting source of chemotherapeutic agents involved in the inhibition of tumor growth. Further investigations to explore the more precise molecular mechanisms and to evaluate its in vivo anticancer properties are necessary. Conflict of InterestThe authors declare no conflicts of interest.Authors' contributions:MH contributed to interpretation of data and preparing the manuscript; MA participated in designing and performing experiments; MHA participated in data analysis; AK conducted the preparation of D.
maritima extracts; FF contributed to analysis and interpretation of data and preparing the manuscript. All authors read and approved the final manuscript. Acknowledgments:The authors would like to thank the financial support of Cellular and Molecular Research Center of Qom University of Medical Sciences and also Shahid Beheshti University of Medical Sciences.
References:1 D.R. Youlden, S.M. Cramb, C.
H. Yip, P.D.
Baade, Incidence and mortality of female breast cancer in the Asia-Pacific region, Cancer. Biol. Med. 11 (2014) 101–115. 2 J. Head, S.R. Johnston, New targets for therapy in breast cancer: Farnesyltransferase inhibitors, Breast.
Cancer. Res. 6 (2004) 262-268.3 H. Yoshida, ER stress and diseases, FEBS. J.
274 (2007) 630-658.4 H. Urra, E. Dufey, F. Lisbona, D. Rojas-Rivera, C. Hetz, When ER stress reaches a dead end, Biochim.
Biophys. Acta. 1833 (2013) 3507–3517.5 W. Rozpedek, D. Pytel, B.
Mucha, H. Leszczy?ska, J. Alan Dieh, I. Majsterek, The role of the PERK/eIF2?/ATF4/CHOP signaling pathway in tumor progression during endoplasmic reticulum stress, Curr. Mol.
Med.16 (2016) 533–544.6 E. Szegezdi, S. E.
Logue, A. M. Gorman, A. Samali, Mediators of endoplasmic reticulum stress-induced apoptosis, EMBO. Rep. 7 (2006) 880–885.7 D.
R. Green, G. Kroemer, The pathophysiology of mitochondrial cell death, Science. 305 (2004) 626-629.
8 W.H. Watson, J. Cai, D.
P. Jones, Diet and apoptosis, Annu. Rev. Nutr. 20 (2000) 485–505.
9 M. Bozorgi, G.H. Amin, M. Shekarchi, R. Rahimi, Traditional medical uses of Drimia species in terms of phytochemistry, pharmacology and toxicology, J. Tradit. Chin.
Med.37 (2017) 124-139.10 F. Naghibi, A. Khalaj, M. Mosaddegh, M. Malekmohamadi, M. Hamzeloo-Moghadam, Cytotoxic activity evaluation of some medicinal plants, selected from Iranian traditional medicine Pharmacopoeia to treat cancer and related disorders, J.
Ethnopharmacol. 155 (2015) 230–239.11 H. Bozcuk, M. Ozdogan, O. Aykurt, F. Topcuoglu, H.
Ozturk, D. Ekinci, A. Karadeniz, A. Mutlu, Urginea maritima (L.) Baker (Liliaceae) extract induces more cytotoxicity than standard chemotherapeutics in the A549 non-small cell lung cancer (NSCLC) cell line, Turk. J.
Med. Sci. 41(2011)101-108. 12 K. Ameri, A.L. Harris, Activating transcription factor 4, Int.
J. Biochem.Cell Biol. 40 (2008) 14-21.13 S.J. Marciniak, C.
Y. Yun, S. Oyadomari, I. Novoa, Y. Zhang, R. Jungreis, K. Nagata, H.
P. Harding, D. Ron, CHOP induces death by promoting protein synthesis and oxidation in the stressed endoplasmic reticulum, Genes. Dev. 18 (2004) 3066–3077.14 B.
Qian, H. Wang, X. Men, W. Zhang, H. Cai, S. Xu, Y.
Xu, L. Ye, C.B. Wollheim, J. Lou, TRIB3 is implicated in glucotoxicity- and oestrogen receptor-stress-induced b-cell apoptosis, J.Endocrinol. 199 (2008) 407–416.15 S.
Nobili, D. Lippib, E. Witort, M. Donninic, L. Bausi, E. Minia, S.
Capacciolic, Natural compounds for cancer treatment and prevention, Pharmacol. Res. 59 (2009) 365–378.16 S.J. Korsmeyer, M.C.
Wei, M. Saito, S. Weiler, K.J. Oh, P.
H. Schlesinger, Pro-apoptotic cascade activates BID, which oligomerizes BAK or BAX into pores that result in the release of cytochrome c, Cell. Death.
Differ. 7 (2000)1166–1173.17 J.C.
Martinou, R.J. Youle, Mitochondria in apoptosis: Bcl-2 family members and mitochondrial dynamics, Dev. Cell. 21 (2011) 92–101.
18 G. Kroemer, L. Galluzzi, C.
Brenner, Mitochondrial Membrane Permeabilization in Cell Death, Physiol. Reveiw.87 (2007) 99-163.19 M. Moeinifard, Z.M. Hassan, F. Fallahian, M.
Hamzeloo-Moghadamd, M. Taghikhania, Britannin induces apoptosis through AKT-FOXO1 pathway in human pancreatic cancer cells, Biomed. Pharmacother. 94 (2017) 1101–1110.20 W. Zeriouh, A. Nani, M.
Belarbi, A. Dumont, C. Rosny, I.
Aboura, F.Z. Ghanemi, B. Murtaza, D. Patoli, C. Thomas, L. Apetoh, C. Reabea, D.
Delmas, N. Akhtar Khan, F. Ghiringhelli, M. Rialland, A. Hichami, Phenolic extract from oleaster (Olea europaeavar. Sylvestris) leaves reduce colon cancer growth and induces caspase-dependent apoptosis in colon cancer cells via the mitochondrial apoptotic pathway, PLoS One.
12 (2017) e0170823. 21 M.H. Brush, D.
C. Weiser, S. Shenolikar, Growth arrest and DNA damageinducible protein GADD34 targets protein phosphatase 1 ? to the endoplasmic reticulum and promotes dephosphorylation of the ? subunit of eukaryotic translation initiation factor 2, Mol.
Cell. Biol. 23 (2003) 1292–1303.22 H.T.
Adler, R. Chinery, D.Y. Wu, S.
J. Kussick, J.M. Payne, A.J. Fornace, D.
C. Tkachuk, Leukemic HRX fusion proteins inhibit GADD34-induced apoptosis and associate with the GADD34 and hSNF5/INI1 proteins, Mol. Cell. Biol. 19 (1999) 7050–7060.23 S.J. Bi, C.Y. Wang, J. Zhang, Z.P. Lv, Y.X. Li, Atorvastatin up-regulates TRIB3 independent of ATF4-CHOP pathway in atherosclerotic patients, Int. J.Clin. Exp. Med. 8 (2015) 21635-21640.24 K.D. McCullough, J.L. Martindale, L.O. Klotz, T.Y. Aw, N.J. Holbrook, Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating Bcl2 and perturbing the cellular redox state Mol. Cell. Biol. 21 (2001) 1249-1259.Figure captions:Fig.1. D.maritima induced growth inhibition in MCF-7 and MDA-MB-468 cells within 48 h of treatment.The MTT assay was carried out as described in the Materials and methods. Each value is presented as mean ± SD of three experiments. Each experiment was conducted in triplicate. *P ; 0.05; **P ; 0.01 compared with the untreated control group.Fig.2. Detection of apoptosis using flow cytometry. Flow cytometric analysis of MCF-7 (a) and MDA-MB-468 (b) cells after treatment with D.maritima for 48 h. The results shown represent the mean ± SD of three independent experiments. Significant differences between control group versus each treated cell line are indicated by *p ; 0.05, **p ; 0.01 and ***p ; 0.001.Fig.3. The effects of D.maritima on the expression of apoptosis-related proteins in MCF-7 (a) and MDA-MB-468 (b) breast cancer cell lines. Cells were treated with the indicated concentrations of D.maritima for 48 h and then analyzed the expression of proteins by Western blotting.Fig.4. Colorimetric assay of caspase-6 activation after treatment with various concentration of D.maritima in MCF-7 and MDA-MB-468 breast cancer cell lines. The activity of caspase-6 increased in a concentration-dependent manner in both cell lines. *P ; 0.05; **P ; 0.01 compared with the untreated control group.Fig.5. Effects of D.maritima on reactive oxygen species (ROS) generation in MCF-7 and MDA-MB-468 cell lines. After treatment with different concentrations of D.maritima for 48 h, cells were loaded with 2?,7?-dichlorofluorescin diacetate and fluorescence was measured by Microplate Reader. Results (mean ± SD) were calculated as percent of corresponding control values. *P ; 0.05; **P ; 0.01 are significant. Fig.6. Effects of D.maritima on mitochondrial transmembrane potential (??m) in MCF-7 and MDA-MB-468 cells. After treatment with different concentrations of D.maritima for 48 h, cells were loaded with JC-1 dye and the potential-dependent accumulation in the mitochondria (reduced ??m indicated by a decrease in red/green fluorescence) measured directly (spectrofluorometry). Data represent the average values from triplicates of three independent experiments. *P ; 0.05; **P ; 0.01 are significant. Fig.7. Real-time PCR analysis of mRNA expression levels of CHOP, ATF-4, TRIB-3 and GADD34 in MCF-7 and MDA-MB-468 cells after treatment with 100 ?g/ml of D.maritima for 48 h. GAPDH was used as an internal control. All data were expressed as mean ± SD of three experiments (*P ; 0.05, **P ; 0.01 vs. control).
